spatial transcriptomics (st) pipeline version 1.7.2 (Spatial Transcriptomics Inc)
90
Structured Review
Spatial Transcriptomics Inc
spatial transcriptomics (st) pipeline version 1.7.2
Spatial Transcriptomics (St) Pipeline Version 1.7.2, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/st_pipeline/spatial+transcriptomics++st++pipeline+version+1+7+2/bio_rxiv__2024__09__13__612892-328-4-2
Average 90 stars, based on 1 article reviews
Spatial Transcriptomics (St) Pipeline Version 1.7.2, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/st_pipeline/spatial+transcriptomics++st++pipeline+version+1+7+2/bio_rxiv__2024__09__13__612892-328-4-2
Average 90 stars, based on 1 article reviews
spatial transcriptomics (st) pipeline version 1.7.2 - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Sequencing:Article Title: Lineage and Spatial Mapping of Glioblastoma-associated Immunity Article Snippet: Electronic copy available at: https://ssrn.com/abstract=3600048 Pr ep ri t n o p ee r r ev ie w ed 22 Sequence Ligation Adapter /5rApp/AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC/3d- dC/ cDNA primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGA PCR primer INPE1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT-CCGATCT PCR primer INPE2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT PCR index primer CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC 548 Postprocessing Spatial Transcriptomics 549 First, we aligned the H&E staining by the use of the st-pipeline (github.com/SpatialTranscriptomics-550 Research/st_pipeline). Article Title: Repopulating Microglia Promote Brain Repair in an IL-6-Dependent Manner. Article Snippet: Analysis pipeline for spatial RNA-seq data implemented the code at Spatial Transcriptomics (https://github.com/SpatialTranscriptomicsResearch), including: st_pipeline, st_viewer, st_spot_ detector, st_tissue_recognition, and st_analysis. Article Title: Identifying CNS-colonizing T cells as potential therapeutic targets to prevent progression of multiple sclerosis Article Snippet: ST pipeline_v1.5.1 , Spatial Transcriptomics , https://github.com/SpatialTranscriptomicsResearch/st_pipeline. Article Title: Spatial transcriptomics reveals the heterogeneity and FGG+CRP+ inflammatory cancer-associated fibroblasts replace islets in pancreatic ductal adenocarcinoma. Article Snippet: Spatial transcriptomics raw data processing Raw sequencing data were processed using the open-source ST pipeline v1.7.2 with the GRCh38 v86 genome assembly as a reference and the corresponding GENCODE annotation file (version 25). Article Title: Multiplexed spatial mapping of chromatin features, transcriptome, and proteins in tissues Article Snippet: Using the Spatial Transcriptomics (ST) pipeline version 1.7.2, this processed data was mapped against the appropriate mouse (GRCm38) genome references. Ligation:Article Title: Lineage and Spatial Mapping of Glioblastoma-associated Immunity Article Snippet: Electronic copy available at: https://ssrn.com/abstract=3600048 Pr ep ri t n o p ee r r ev ie w ed 22 Sequence Ligation Adapter /5rApp/AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC/3d- dC/ cDNA primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGA PCR primer INPE1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT-CCGATCT PCR primer INPE2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT PCR index primer CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC 548 Postprocessing Spatial Transcriptomics 549 First, we aligned the H&E staining by the use of the st-pipeline (github.com/SpatialTranscriptomics-550 Research/st_pipeline). Article Title: Repopulating Microglia Promote Brain Repair in an IL-6-Dependent Manner. Article Snippet: Analysis pipeline for spatial RNA-seq data implemented the code at Spatial Transcriptomics (https://github.com/SpatialTranscriptomicsResearch), including: st_pipeline, st_viewer, st_spot_ detector, st_tissue_recognition, and st_analysis. Article Title: Identifying CNS-colonizing T cells as potential therapeutic targets to prevent progression of multiple sclerosis Article Snippet: ST pipeline_v1.5.1 , Spatial Transcriptomics , https://github.com/SpatialTranscriptomicsResearch/st_pipeline. Article Title: Spatial transcriptomics reveals the heterogeneity and FGG+CRP+ inflammatory cancer-associated fibroblasts replace islets in pancreatic ductal adenocarcinoma. Article Snippet: Spatial transcriptomics raw data processing Raw sequencing data were processed using the open-source ST pipeline v1.7.2 with the GRCh38 v86 genome assembly as a reference and the corresponding GENCODE annotation file (version 25). Article Title: Multiplexed spatial mapping of chromatin features, transcriptome, and proteins in tissues Article Snippet: Using the Spatial Transcriptomics (ST) pipeline version 1.7.2, this processed data was mapped against the appropriate mouse (GRCm38) genome references. Polymerase Chain Reaction:Article Title: Lineage and Spatial Mapping of Glioblastoma-associated Immunity Article Snippet: Electronic copy available at: https://ssrn.com/abstract=3600048 Pr ep ri t n o p ee r r ev ie w ed 22 Sequence Ligation Adapter /5rApp/AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC/3d- dC/ cDNA primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGA PCR primer INPE1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT-CCGATCT PCR primer INPE2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT PCR index primer CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC 548 Postprocessing Spatial Transcriptomics 549 First, we aligned the H&E staining by the use of the st-pipeline (github.com/SpatialTranscriptomics-550 Research/st_pipeline). Article Title: Repopulating Microglia Promote Brain Repair in an IL-6-Dependent Manner. Article Snippet: Analysis pipeline for spatial RNA-seq data implemented the code at Spatial Transcriptomics (https://github.com/SpatialTranscriptomicsResearch), including: st_pipeline, st_viewer, st_spot_ detector, st_tissue_recognition, and st_analysis. Article Title: Identifying CNS-colonizing T cells as potential therapeutic targets to prevent progression of multiple sclerosis Article Snippet: ST pipeline_v1.5.1 , Spatial Transcriptomics , https://github.com/SpatialTranscriptomicsResearch/st_pipeline. Article Title: Spatial transcriptomics reveals the heterogeneity and FGG+CRP+ inflammatory cancer-associated fibroblasts replace islets in pancreatic ductal adenocarcinoma. Article Snippet: Spatial transcriptomics raw data processing Raw sequencing data were processed using the open-source ST pipeline v1.7.2 with the GRCh38 v86 genome assembly as a reference and the corresponding GENCODE annotation file (version 25). Article Title: Multiplexed spatial mapping of chromatin features, transcriptome, and proteins in tissues Article Snippet: Using the Spatial Transcriptomics (ST) pipeline version 1.7.2, this processed data was mapped against the appropriate mouse (GRCm38) genome references. Staining:Article Title: Lineage and Spatial Mapping of Glioblastoma-associated Immunity Article Snippet: Electronic copy available at: https://ssrn.com/abstract=3600048 Pr ep ri t n o p ee r r ev ie w ed 22 Sequence Ligation Adapter /5rApp/AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC/3d- dC/ cDNA primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGA PCR primer INPE1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT-CCGATCT PCR primer INPE2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT PCR index primer CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC 548 Postprocessing Spatial Transcriptomics 549 First, we aligned the H&E staining by the use of the st-pipeline (github.com/SpatialTranscriptomics-550 Research/st_pipeline). Article Title: Repopulating Microglia Promote Brain Repair in an IL-6-Dependent Manner. Article Snippet: Analysis pipeline for spatial RNA-seq data implemented the code at Spatial Transcriptomics (https://github.com/SpatialTranscriptomicsResearch), including: st_pipeline, st_viewer, st_spot_ detector, st_tissue_recognition, and st_analysis. Article Title: Identifying CNS-colonizing T cells as potential therapeutic targets to prevent progression of multiple sclerosis Article Snippet: ST pipeline_v1.5.1 , Spatial Transcriptomics , https://github.com/SpatialTranscriptomicsResearch/st_pipeline. Article Title: Spatial transcriptomics reveals the heterogeneity and FGG+CRP+ inflammatory cancer-associated fibroblasts replace islets in pancreatic ductal adenocarcinoma. Article Snippet: Spatial transcriptomics raw data processing Raw sequencing data were processed using the open-source ST pipeline v1.7.2 with the GRCh38 v86 genome assembly as a reference and the corresponding GENCODE annotation file (version 25). Article Title: Multiplexed spatial mapping of chromatin features, transcriptome, and proteins in tissues Article Snippet: Using the Spatial Transcriptomics (ST) pipeline version 1.7.2, this processed data was mapped against the appropriate mouse (GRCm38) genome references. |